DNA Sequence Search Tool
The DNA Sequence Search Tool is designed to assist users in verifying the identity of tortricid specimens, primarily larvae.
The tool searches for an exact match between the input sequence and the reference database, which contains more than 800 COI haplotypes of over 300
target and non-target species from around the world. Each haplotype consists of a 658bp sequence of the region of COI commonly known as
the DNA barcode region. The search tool assumes that the input sequence was generated using primers designed to amplify the
COI barcode region and that the sequence has been properly trimmed and the primer sequences removed. A sequence that is too long will
not return a match regardless of the specimen identity. Input sequences must be verified to be of sufficient length, to be free of primers,
and to not contain excessive ambiguous data. Sequences are automatically verified when the user clicks the "Submit Query" button.
The search tool will return the name and description of haplotype(s) if a match is found. A message that
the sequence is consistent with one or more haplotypes means that the input sequence exactly (100%) matches one of the reference sequences.
This information can be used to assist with specimen identity, but the results should be used with caution. It is possible that sequencing
or identification errors in the reference database could lead to misidentifications; however, the possibility of false positives is greatly
reduced with an exact matching algorithm. A message that the sequence is not consistent with any haplotypes in the database
means that the input sequence does not exactly match any of the reference sequences. This could be due to errors in the input sequence or a
failure to sample all haplotypes of a particular species in the reference database, and the lack of a match should be treated as an inconclusive
result. Alternative molecular databases (Genbank or BOLD) can be consulted if no match is found. A link to these resources is provided on the
help file at the bottom of the DNA sequence search tool page. A complete list of the sequences contained in the search tool database (.xml file) can be
found here (PDF - opens in a new window): DNA_data_log.pdf.
Instructions
Search sequences should be generated with one of three common primer
sets used to target the DNA barcode region of Cytochrome oxidase I (COI). Acceptable primer sets are listed below:
| Forward Primer |
Sequence |
Reverse Primer |
Sequence |
| LepF1* |
ATTCAACCAATCATAAAGATATTGG |
LepR1* |
TAAACTTCTGGATGTCCAAAAAATCA |
| LCO-1490* |
GGTCAACAAATCATAAAGATATTGG |
HCO-2198* |
TAAACTTCAGGGTGACCAAAAAATCA |
| TY-J-1460 |
TACAATTTATCGCCTAAACTTCAGCC |
C1-N-2191 |
CCCGGTAAAATTAAAATATAAACTTC |
* Recommended primer sets
Trim the sequence between the primer sets. While the above primer sets generate sequences approximately 650bp long, a shorter
fragment can be used if the sequence is degraded (probably requiring different primers). Final sequence length should be between between 200-700bp.
Cut and paste the sequence into the DNA sequence search tool query window. Make sure the sequence contains no blank spaces, line breaks,
or return characters. Click "Submit Query" to submit the sequence to the search tool. The search tool will automatically check the sequence
for any problems (length, primers, long strings of NNN's). If the sequence verifies, you will receive a message stating
"Sequence is verified to be of the correct length and to not contain any primer sequences or excessive ambiguous data. Click OK to search the database."
If the sequence does not verify, you will receive a message stating the reason, and be returned to the query window to correct the problem.
Successful searches will return the following message: "Your sequence is consistent with the following taxa. Exact matches to the reference sequence(s)
are displayed in red." Complete sequences will be displayed below the query window with matching regions highlighted in red.
Failed searches will return the following message: "Your sequence is not consistent with any taxa in the database. Please make sure the sequence
does not have any return characters, including at the end. If you received this message after ensuring that your sequence is formatted correctly and
verified, your search was inconclusive. Please view the link at the bottom of this page for suggestions."
Further information on steps to take if your search failed can be found on the DNA Sequence Search Tool - no match with the database page.
Disclaimer
While the authors have made every effort to provide accurate an sequence matching algorithm with the DNA sequence search tool, the authors, Colorado State University,
the California Department of Food and Agriculture, and USDA/APHIS/PPQ/CPHST specifically disclaim all legal liability with respect to the accuracy,
completeness, or usefulness of the DNA sequence search tool. The authors and associated institutions shall assume no legal liability for any damages,
including direct, indirect, consequential, compensatory, special, punitive, or incidental damages arising from or relating to the use of the DNA Sequence
Search Tool for any purpose.
|
